ID: 1128649148_1128649156

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1128649148 1128649156
Species Human (GRCh38) Human (GRCh38)
Location 15:69397857-69397879 15:69397874-69397896
Sequence CCCACACCCAGGTGCTGCCTTGG CCTTGGTGGCACTTGAGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 333} {0: 1, 1: 1, 2: 1, 3: 17, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!