ID: 1128651172_1128651184

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1128651172 1128651184
Species Human (GRCh38) Human (GRCh38)
Location 15:69414673-69414695 15:69414694-69414716
Sequence CCCTGCCGCGTCGCCCCCCGCCG CGCCCCGCCTGGGCCTCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 244} {0: 1, 1: 0, 2: 0, 3: 57, 4: 1121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!