ID: 1128687797_1128687806

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1128687797 1128687806
Species Human (GRCh38) Human (GRCh38)
Location 15:69699705-69699727 15:69699745-69699767
Sequence CCGACCCCACCGTGGCCTGGGAC CAGCCTCCCCTCACTGACCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 285} {0: 1, 1: 0, 2: 0, 3: 29, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!