ID: 1128713271_1128713276

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1128713271 1128713276
Species Human (GRCh38) Human (GRCh38)
Location 15:69887880-69887902 15:69887897-69887919
Sequence CCAGGCAGAGGGACCAGCAGGAG CAGGAGAAAAGGAAGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 75, 3: 434, 4: 1621} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!