ID: 1128723677_1128723685

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1128723677 1128723685
Species Human (GRCh38) Human (GRCh38)
Location 15:69972076-69972098 15:69972119-69972141
Sequence CCAAGGAGTCTGAGGCTTTCCAG CTGGCCTGCTTGGTCAAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 600} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!