ID: 1128735489_1128735493

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1128735489 1128735493
Species Human (GRCh38) Human (GRCh38)
Location 15:70051467-70051489 15:70051519-70051541
Sequence CCTGCAGGTGGGAGGCAAAGGCA AGCAAGACCTGCCCTAGACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 285, 4: 1377} {0: 1, 1: 0, 2: 4, 3: 15, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!