ID: 1128809324_1128809336

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1128809324 1128809336
Species Human (GRCh38) Human (GRCh38)
Location 15:70559298-70559320 15:70559347-70559369
Sequence CCTCCAGTCCAGGCTGCCTGTGT TGCAGGAAATGAGAGGCCACAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 30, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!