ID: 1128857535_1128857540

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1128857535 1128857540
Species Human (GRCh38) Human (GRCh38)
Location 15:71031945-71031967 15:71031971-71031993
Sequence CCCACTGAGTGAGACCACTTGGC CTGGCTTCAGACCGCTTTCCAGG
Strand - +
Off-target summary {0: 15, 1: 60, 2: 135, 3: 180, 4: 267} {0: 1, 1: 10, 2: 663, 3: 617, 4: 424}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!