|
Left Crispr |
Right Crispr |
Crispr ID |
1128857535 |
1128857540 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:71031945-71031967
|
15:71031971-71031993
|
Sequence |
CCCACTGAGTGAGACCACTTGGC |
CTGGCTTCAGACCGCTTTCCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 15, 1: 60, 2: 135, 3: 180, 4: 267} |
{0: 1, 1: 10, 2: 663, 3: 617, 4: 424} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|