|
Left Crispr |
Right Crispr |
| Crispr ID |
1128874669 |
1128874672 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:71192373-71192395
|
15:71192395-71192417
|
| Sequence |
CCCAGGTTCAAGTGATTCTCTTG |
GCCTCAAGTACCCGAGTGGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1042, 1: 25818, 2: 93395, 3: 151939, 4: 170191} |
{0: 1, 1: 0, 2: 4, 3: 376, 4: 9749} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|