ID: 1128874670_1128874674

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1128874670 1128874674
Species Human (GRCh38) Human (GRCh38)
Location 15:71192374-71192396 15:71192396-71192418
Sequence CCAGGTTCAAGTGATTCTCTTGC CCTCAAGTACCCGAGTGGCTGGG
Strand - +
Off-target summary {0: 1676, 1: 40591, 2: 89463, 3: 105531, 4: 123425} {0: 1, 1: 0, 2: 6, 3: 438, 4: 10948}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!