ID: 1128888269_1128888276

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1128888269 1128888276
Species Human (GRCh38) Human (GRCh38)
Location 15:71308076-71308098 15:71308103-71308125
Sequence CCAACCTCCTCTACCCTCCAGCA CAGGCATTCACCCTGAATACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 597} {0: 1, 1: 0, 2: 1, 3: 11, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!