ID: 1128896220_1128896226

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1128896220 1128896226
Species Human (GRCh38) Human (GRCh38)
Location 15:71376471-71376493 15:71376501-71376523
Sequence CCAGACCACCAACCCTTGTTCTG ACCTTTTTCTGGCCATTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 13, 4: 173} {0: 1, 1: 0, 2: 5, 3: 24, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!