ID: 1128896220_1128896229

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1128896220 1128896229
Species Human (GRCh38) Human (GRCh38)
Location 15:71376471-71376493 15:71376506-71376528
Sequence CCAGACCACCAACCCTTGTTCTG TTTCTGGCCATTCTGTGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 13, 4: 173} {0: 1, 1: 0, 2: 3, 3: 27, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!