ID: 1128904811_1128904816

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1128904811 1128904816
Species Human (GRCh38) Human (GRCh38)
Location 15:71457431-71457453 15:71457479-71457501
Sequence CCTTGCCCATTCTGGCTGGGGCT GCCGTCCAGTCTCCTTGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 295} {0: 1, 1: 0, 2: 0, 3: 14, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!