ID: 1128907948_1128907957

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1128907948 1128907957
Species Human (GRCh38) Human (GRCh38)
Location 15:71485042-71485064 15:71485081-71485103
Sequence CCCAGCTCCTCTAGAGGCTAGTG AAAGAGGGCTGGGCTGACTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 118, 4: 2943} {0: 1, 1: 0, 2: 1, 3: 11, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!