ID: 1128927744_1128927748

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1128927744 1128927748
Species Human (GRCh38) Human (GRCh38)
Location 15:71674230-71674252 15:71674261-71674283
Sequence CCAGTTCTTGGCCTTGTCTTCCA CCAGCTCTGCCCATTGAAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 275} {0: 1, 1: 0, 2: 1, 3: 18, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!