ID: 1128947098_1128947100

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1128947098 1128947100
Species Human (GRCh38) Human (GRCh38)
Location 15:71832577-71832599 15:71832600-71832622
Sequence CCAAGCTTGATTGTTATATACAG AAAATAATTTTCAGGAATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 117} {0: 1, 1: 1, 2: 31, 3: 259, 4: 1444}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!