ID: 1128955107_1128955108

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1128955107 1128955108
Species Human (GRCh38) Human (GRCh38)
Location 15:71932584-71932606 15:71932616-71932638
Sequence CCTCAAACAATGGCTAGAGAAGT AACCCCTTCCAGAAATTAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 260} {0: 1, 1: 0, 2: 1, 3: 12, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!