ID: 1128956187_1128956190

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1128956187 1128956190
Species Human (GRCh38) Human (GRCh38)
Location 15:71948114-71948136 15:71948140-71948162
Sequence CCATTTCTTGGAAGCAAGTCACT TACAGGACATGCCTTATGAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 40, 4: 638} {0: 1, 1: 0, 2: 1, 3: 6, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!