|
Left Crispr |
Right Crispr |
Crispr ID |
1128991932 |
1128991940 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:72267977-72267999
|
15:72268000-72268022
|
Sequence |
CCCGACTTCAGGTGACCTACCGG |
CCTCGGCCTCCCAAATTGCTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 5, 2: 222, 3: 5584, 4: 57770} |
{0: 1115, 1: 130706, 2: 290729, 3: 319061, 4: 327272} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|