ID: 1128991932_1128991940

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1128991932 1128991940
Species Human (GRCh38) Human (GRCh38)
Location 15:72267977-72267999 15:72268000-72268022
Sequence CCCGACTTCAGGTGACCTACCGG CCTCGGCCTCCCAAATTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 222, 3: 5584, 4: 57770} {0: 1115, 1: 130706, 2: 290729, 3: 319061, 4: 327272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!