ID: 1128992927_1128992934

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1128992927 1128992934
Species Human (GRCh38) Human (GRCh38)
Location 15:72275399-72275421 15:72275428-72275450
Sequence CCCTCCAAACATTTGAATCTCTC TTTCTGTTTCAGAAGTGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 225} {0: 1, 1: 0, 2: 4, 3: 53, 4: 467}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!