ID: 1128995758_1128995765

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1128995758 1128995765
Species Human (GRCh38) Human (GRCh38)
Location 15:72293198-72293220 15:72293248-72293270
Sequence CCTTGATTGTGTTTGACAGGAGG CTCAGGTGACCCAGAAATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 119} {0: 1, 1: 0, 2: 3, 3: 27, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!