|
Left Crispr |
Right Crispr |
Crispr ID |
1129000973 |
1129000975 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:72333582-72333604
|
15:72333605-72333627
|
Sequence |
CCAGTTGCTCTCAAACTCCTGGA |
TTCAAGTGATCCTCCTGTCTTGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 4, 2: 57, 3: 494, 4: 1678} |
{0: 34, 1: 923, 2: 8482, 3: 28932, 4: 69258} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|