|
Left Crispr |
Right Crispr |
| Crispr ID |
1129000973 |
1129000978 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:72333582-72333604
|
15:72333621-72333643
|
| Sequence |
CCAGTTGCTCTCAAACTCCTGGA |
GTCTTGGCTTCCCAAAGTGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 57, 3: 494, 4: 1678} |
{0: 172, 1: 6258, 2: 71665, 3: 185385, 4: 222853} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|