|
Left Crispr |
Right Crispr |
| Crispr ID |
1129018260 |
1129018265 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:72488982-72489004
|
15:72488997-72489019
|
| Sequence |
CCTGCAATCCCACAACTTTGGGA |
CTTTGGGAGGTTGAGGCCAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 265, 2: 15165, 3: 337369, 4: 260335} |
{0: 15, 1: 549, 2: 5174, 3: 61965, 4: 157681} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|