ID: 1129067508_1129067514

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1129067508 1129067514
Species Human (GRCh38) Human (GRCh38)
Location 15:72918621-72918643 15:72918660-72918682
Sequence CCCACAGGATTAAGCTCCAGGCA CTTGATAATACACCTTTTATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 161} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!