ID: 1129106257_1129106263

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1129106257 1129106263
Species Human (GRCh38) Human (GRCh38)
Location 15:73309343-73309365 15:73309356-73309378
Sequence CCCCAGATTCCTGGAACACTGCA GAACACTGCAAGGGCAATACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!