ID: 1129141068_1129141074

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1129141068 1129141074
Species Human (GRCh38) Human (GRCh38)
Location 15:73598400-73598422 15:73598433-73598455
Sequence CCTACCTCTAATTGCCCATAATT TACACTTCCATAAGACAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 112} {0: 1, 1: 0, 2: 0, 3: 12, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!