ID: 1129142690_1129142695

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1129142690 1129142695
Species Human (GRCh38) Human (GRCh38)
Location 15:73614911-73614933 15:73614957-73614979
Sequence CCTTAGAAGTTACCTTTTGTTTA GTTTGTTTTCTAACAAGCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 301} {0: 1, 1: 0, 2: 3, 3: 35, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!