ID: 1129156140_1129156152

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1129156140 1129156152
Species Human (GRCh38) Human (GRCh38)
Location 15:73719394-73719416 15:73719433-73719455
Sequence CCCTCCCCCTTCTCCTTTCACGG GTGTCTCTCCCGTCACCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 494} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!