ID: 1129158087_1129158102

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1129158087 1129158102
Species Human (GRCh38) Human (GRCh38)
Location 15:73731325-73731347 15:73731359-73731381
Sequence CCCTCCCCCTTCCCCTTCCCCAC GACTTGTGTCCGGAATCCGTAGG
Strand - +
Off-target summary {0: 1, 1: 13, 2: 307, 3: 3642, 4: 17262} {0: 1, 1: 0, 2: 2, 3: 15, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!