ID: 1129158362_1129158368

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1129158362 1129158368
Species Human (GRCh38) Human (GRCh38)
Location 15:73732778-73732800 15:73732801-73732823
Sequence CCCACCACTGGCCATCGTGTGTC AAGGAACCCCACAAAGATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 150} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!