ID: 1129162235_1129162256

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1129162235 1129162256
Species Human (GRCh38) Human (GRCh38)
Location 15:73753197-73753219 15:73753247-73753269
Sequence CCAAGCGCCGCGGCGCCGCGCCG CCCGCCGCCCCCCGCCGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 329} {0: 1, 1: 0, 2: 4, 3: 66, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!