ID: 1129162239_1129162261

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1129162239 1129162261
Species Human (GRCh38) Human (GRCh38)
Location 15:73753217-73753239 15:73753255-73753277
Sequence CCGCCCGCGCCCCGGCCGCCCCC CCCCCGCCGGACTGGCCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 54, 3: 395, 4: 2641} {0: 1, 1: 0, 2: 1, 3: 17, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!