ID: 1129162245_1129162263

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1129162245 1129162263
Species Human (GRCh38) Human (GRCh38)
Location 15:73753228-73753250 15:73753256-73753278
Sequence CCGGCCGCCCCCGGCCCGCCCCG CCCCGCCGGACTGGCCGCCCGGG
Strand - +
Off-target summary {0: 2, 1: 6, 2: 35, 3: 325, 4: 2093} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!