|
Left Crispr |
Right Crispr |
Crispr ID |
1129162249 |
1129162273 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:73753237-73753259
|
15:73753278-73753300
|
Sequence |
CCCGGCCCGCCCCGCCGCCCCCC |
GCGGGCGCTGGCTCCCTTAAAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 3, 2: 47, 3: 669, 4: 3409} |
{0: 1, 1: 0, 2: 0, 3: 5, 4: 47} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|