ID: 1129162251_1129162274

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1129162251 1129162274
Species Human (GRCh38) Human (GRCh38)
Location 15:73753242-73753264 15:73753286-73753308
Sequence CCCGCCCCGCCGCCCCCCGCCGG TGGCTCCCTTAAAGGCCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 52, 3: 335, 4: 2268} {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!