ID: 1129177402_1129177413

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1129177402 1129177413
Species Human (GRCh38) Human (GRCh38)
Location 15:73849774-73849796 15:73849814-73849836
Sequence CCCCAGCCCTGCCCAGTCACAAG GTGCAGAAGAAGGCTCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 454} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!