ID: 1129196917_1129196926

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1129196917 1129196926
Species Human (GRCh38) Human (GRCh38)
Location 15:73973822-73973844 15:73973849-73973871
Sequence CCGCGGGCCCCGCACTCGGTGCG GCCGGCCGGCCCGCAAGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 12, 3: 27, 4: 139} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!