ID: 1129199615_1129199622

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1129199615 1129199622
Species Human (GRCh38) Human (GRCh38)
Location 15:73991250-73991272 15:73991284-73991306
Sequence CCTGGAGATTCAGGAGCCCAAGT CCGAGACAGCTCCAGAATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 280} {0: 1, 1: 0, 2: 0, 3: 15, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!