ID: 1129204700_1129204710

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1129204700 1129204710
Species Human (GRCh38) Human (GRCh38)
Location 15:74030024-74030046 15:74030055-74030077
Sequence CCCACCGCGGGGTTCTGGTACCT CAGGAGCCAGCACTGTGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 33} {0: 1, 1: 0, 2: 4, 3: 50, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!