ID: 1129217749_1129217756

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1129217749 1129217756
Species Human (GRCh38) Human (GRCh38)
Location 15:74110019-74110041 15:74110063-74110085
Sequence CCTTGGCTCGAGCAATTCACCTG CTTTTTAAATACATGTATTTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 245, 3: 6883, 4: 74701} {0: 1, 1: 4, 2: 9, 3: 145, 4: 975}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!