ID: 1129230197_1129230209

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1129230197 1129230209
Species Human (GRCh38) Human (GRCh38)
Location 15:74192810-74192832 15:74192853-74192875
Sequence CCTCCTCCTCTCTCACCAGAAAG TGCACCACAGTCCCAACACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 404} {0: 1, 1: 0, 2: 3, 3: 13, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!