ID: 1129232632_1129232640

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1129232632 1129232640
Species Human (GRCh38) Human (GRCh38)
Location 15:74205261-74205283 15:74205304-74205326
Sequence CCTGACTCTGGGTAACTTAGAAG CACAGTTCTGCAGGCTGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 121, 4: 1691} {0: 35, 1: 700, 2: 1424, 3: 2775, 4: 3506}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!