ID: 1129242803_1129242809

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1129242803 1129242809
Species Human (GRCh38) Human (GRCh38)
Location 15:74261561-74261583 15:74261605-74261627
Sequence CCCTGCTACAGGATCTCTGGGAT TGCAGTTAATGGAGCAGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 147} {0: 1, 1: 0, 2: 1, 3: 10, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!