ID: 1129263976_1129263981

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1129263976 1129263981
Species Human (GRCh38) Human (GRCh38)
Location 15:74384126-74384148 15:74384166-74384188
Sequence CCACATAGCAGCTGCTTCAGATC GGGCTTTTTCACCAAGCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 181} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!