ID: 1129266415_1129266419

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1129266415 1129266419
Species Human (GRCh38) Human (GRCh38)
Location 15:74395801-74395823 15:74395817-74395839
Sequence CCTCACAGAGGCAGAGCTGAGTC CTGAGTCAGCAGCCAGGGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 325} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!