ID: 1129269509_1129269520

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1129269509 1129269520
Species Human (GRCh38) Human (GRCh38)
Location 15:74411979-74412001 15:74412011-74412033
Sequence CCCGGTTCCACCACCTTGTGGAT GTCTGTGTATGGTGGACAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 146} {0: 1, 1: 0, 2: 0, 3: 31, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!