ID: 1129292781_1129292791

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1129292781 1129292791
Species Human (GRCh38) Human (GRCh38)
Location 15:74581164-74581186 15:74581192-74581214
Sequence CCTGCCCTCCCGCCCCCATCAGT TCAAGGCTGCAAACTGACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 63, 4: 539} {0: 1, 1: 0, 2: 0, 3: 17, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!