ID: 1129294396_1129294401

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1129294396 1129294401
Species Human (GRCh38) Human (GRCh38)
Location 15:74591929-74591951 15:74591944-74591966
Sequence CCCTCCAGGTTCTGCCTTCCAGG CTTCCAGGCCCCTAGAAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 480} {0: 1, 1: 0, 2: 3, 3: 14, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!